We narrowed to 3,581 results for: arl
-
Plasmid#182934PurposeExpresses enpp-1 (C27A7.1) under its native promoter (male reproductive tract and ciliated neurons IL2, CEMs, HOB, RnBs in C. elegans)DepositorInsertgenomic enpp-1 fused to mScarlet
Tagsflexible linker (GGGGS)x3 and mScarlet tagExpressionWormPromoterenpp-1Available sinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT335-mScarletI
Plasmid#174506PurposeHigh-copy number plasmid (pMT335) harboring the mScarletI gene for its cytoplasmic expression, inducible by vanillate (sequence of mScarletI optimized)DepositorInsertmScarletI
TagsmScarletIExpressionBacterialAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIN2_mcm-3_mScarlet
Plasmid#182933PurposeExpresses mcm-3 under its native promoter (embryonic nuclei and ciliated neurons IL2, CEMs, HOB, RnBs in C. elegans)DepositorInsertgenomic mcm-3 fused to mScarlet
Tagsflexible linker (GGGGS)x3 and mScarlet tagExpressionWormPromotermcm-3Available sinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPL13A_PQR_mScarlet_NOL_LoxP_PQR_zeo_PQR_MCS_RPL13A-3'UTR
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
68Q-ymScarlet
Plasmid#128562PurposeHttex1 (without proline-rich region) fused to ymScarletDepositorInsert68Q-Httex1 (without proline-rich region) fused to ymSarlet
TagsymScarletExpressionYeastPromoterGal1Available sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
25Q-ymScarlet
Plasmid#128561PurposeHttex1 (without proline-rich region) fused to ymScarletDepositorInsert25Q-Httex1 (without proline-rich region) fused to ymSarlet
TagsymScarletExpressionYeastPromoterGAL1Available sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
sugarless cDNA
Plasmid#42063DepositorInsertsugarless (sgl Fly)
Available sinceFeb. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-SV40NLSf-mScarlet-P2A-hLuc-WPRE
Plasmid#203539PurposeAAV reporter genome plasmidDepositorInsertNLS-mScarlet-2A-mScarlet
UseAAVExpressionMammalianAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEM388 - mosTI unc-119 - NNN - mScarlet - tbb-2
Plasmid#182348PurposemScarlet fusion cloning vector for mosTI(unc-119). Transgene inserted upstream of mScarlet and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneExpressionWormAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Dlx5/6-Chronos-eGFP-p2a-nls-mScarlet
Plasmid#121543PurposeChronos with red nucleus-targeted fluorescence for inhibitory neuronsDepositorInsertblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet
UseAAVPromoterdlx5/6Available sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet3-S2 (JDW 1514)
Plasmid#242552PurposeGateway middle entry clone containing H2B-mScarlet3-S2; Nuclear red fluorescent reporterDepositorInsertmScarlet3-S2
UseGateway CloningAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-EGFP-IRES-E3
Plasmid#242408PurposeSelf-amplifying RNA (saRNA) E3 construct; expresses the vaccinia virus E3 protein, which binds and sequesters dsRNA broadly inhibiting dsRNA-sensing pathwaysDepositorPublicationInsertsmScarlet3
IRES-EGFP
IRES-E3
UseSelf-amplifying rnaExpressionMammalianAvailable sinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC7-pA
Plasmid#220771PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC7
UseAAVPromoterCAGAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+) pCopA RBS30 mscarlet
Plasmid#226370PurposePlasmid carries copper sensor circuit genes for whole-cell sensing of copper ions with RBS30DepositorInsertmScarlet
Tags6x HistagExpressionBacterialPromotercopA promoter (pCopA)Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC4-pA
Plasmid#220768PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC4
UseAAVPromoterCAGAvailable sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast-ARL13B
Plasmid#227278PurposeDonor template for mStayGold-EFS-Blast insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertARL13B Homology Arms flanking a mStayGold-EFS-Blast Cassette (ARL13B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-mScarlet-TEV-Strep-His
Plasmid#210823PurposeBacterial overexpression vector for C-terminally Strep and His tagged mScarlet fluorescent proteinDepositorInsertmScarlet
TagsTwinStrep, 10xHisExpressionBacterialPromoterT7Available sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC6-pA
Plasmid#220770PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC6
UseAAVPromoterCAGAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC11-pA
Plasmid#220775PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC11
UseAAVPromoterCAGAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only