We narrowed to 11,616 results for: 110
-
Plasmid#240327PurposeEntry vector for Gateway with MGADepositorInsertMGA (MGA Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gnaq
Plasmid#246001PurposeExpress HA N-terminal tagged mouse Galphaq transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG5-CAGEc-PRKACA (Nrdj1)
Plasmid#241421PurposeProximity-triggered Protein Trans-Splicing to generate the splice product DNAJ-PKAc, Figure 4, Extended Figure 8-9 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMef2c-AHF-DEST (JDW 476)
Plasmid#242577PurposeGateway destination vector with the murine Mef2c anterior heart field promoter in the backbone.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-DRE-nls (JDW 31)
Plasmid#242561PurposeGateway middle entry clone containing Dre recombinaseDepositorInsertcodon optimized DRE-nls
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-mCherry-SV40-pA (JDW 1417)
Plasmid#242570PurposeGateway 3' entry clone containing mCherry followed by an SV40 polyA.DepositorInsertmCherry stop SV40 pA
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11cag
Plasmid#245370PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11cag (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus 3 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7cg
Plasmid#245371PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7cg (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29, plus 2 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Nrdj1)
Plasmid#241416PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Nrdj1) (HOXA9 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Npu)
Plasmid#241415PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Npu) (HOXA9 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG5-DNAJB1n_CAGEn (Nrdj1)
Plasmid#241422PurposeProximity-triggered Protein Trans-Splicing to generate the splice product DNAJ-PKAc, Figure 4, Extended Figure 8-9 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet-3H (JDW 1513)
Plasmid#242551PurposeGateway middle entry clone containing H2B-mScarlet-3H; Nuclear red fluorescent reporterDepositorInsertmScarlet3-H
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3
Plasmid#240233PurposeExpression of Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertMyc-BirA*G3
ExpressionInsectPromoterMTAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only