We narrowed to 29,073 results for: Tat
-
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.1kb-USF
Plasmid#227474Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.1kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USP
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-58kb-USF
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-36kb-USF
Plasmid#227462Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-33kb-USF
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101N
Plasmid#224348PurposeExpresses human KDAC8 (HDAC8) D101N in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to asparaginePromoterT5Available SinceFeb. 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3_5UTR_Myc_FLuc Compensatory Mutant
Plasmid#229504PurposeMyc 5' untranslated region firefly luciferase reporter with compensatory mutations in the region bound by RBM42DepositorInsertMyc 5'UTR_CompMutant
ExpressionMammalianMutationMutations in bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ 3xFLAG-FEM1B C186S
Plasmid#230995PurposeTransient overexpression of mouse FEM1B in mammalian cells. Mutation abolishes substrate binding.DepositorAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ 3xFLAG-FEM1B L597A
Plasmid#230994PurposeTransient overexpression of catalytic null mouse FEM1B in mammalian cells. Mutation abolishes interaction with CUL2.DepositorAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-MBD6MBD
Plasmid#228233PurposeFor targeted tethering of the MBD domain of human MBD6 using dCas13DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-Dual-MBP-NavAb (KAV/G94C/Q150C)
Plasmid#226884PurposeExpresses a mutant of the Arcobacter butzleri voltage-gated sodium channel fused to an MBP tag in insect cellsDepositorInsertNaVAb
TagsMBPExpressionInsectMutationR4A, N49K, L109A, M116VPromoterPolyhedrinAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101R
Plasmid#224349PurposeExpresses human KDAC8 (HDAC8) D101R in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to argininePromoterT5Available SinceOct. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJExpress401-KDAC8 D101A
Plasmid#224347PurposeExpresses human KDAC8 (HDAC8) D101A in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to alaninePromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits