We narrowed to 13,796 results for: CAN
-
Plasmid#185248PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_15. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertPvLEA4_repeats_k5_15
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k5_1 (pBS0766)
Plasmid#185247PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k4_14 (pBS0764)
Plasmid#185246PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k4_14. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k4_14
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k4_1 (pBS0763)
Plasmid#185245PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k4_1. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k4_1
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k3_11 (pBS0761)
Plasmid#185243PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_11. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k3_11
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_dom3_k5_0 (pBS0758)
Plasmid#185242PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_dom3_k5_0. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_dom3_k5_0
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_dom3_k3_7 (pBS0755)
Plasmid#185241PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_dom3_k3_7. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertDrHD_dom3_k3_7
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_dom3_k3_1 (pBS0754)
Plasmid#185240PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_dom3_k3_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_dom3_k3_1
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CI016_HUMAN (pBS0747)
Plasmid#185238PurposeFor the mammalian expression of the human protein CI016_HUMAN. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertCI016_HUMAN
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AdHsAPO-44 (pBS0746)
Plasmid#185237PurposeFor the mammalian expression of the Chinese giant salamander and human fusion protein AdHsAPO-44. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAdHsAPO-44
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AdAPOA4-44 (pBS0745)
Plasmid#185236PurposeFor the mammalian expression of the Chinese giant salamander protein AdAPOA4-44. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAdAPOA4-44
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_ANDDA_52-358 (pBS0744)
Plasmid#185235PurposeFor the mammalian expression of the Chinese giant salamander protein APOA4_ANDDA_52-358. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_ANDDA_52-358
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS97splitRBP_S1-Enz
Plasmid#183767PurposeExpresses SHIP1-Enzyme domain flanked by RBPDepositorInsertSHIP1 (INPP5D Human)
Tags6HIS, RBP (C-terminal) w/HRV3C cleavage site, and…ExpressionBacterialMutationincludes aa N393 to aa L864 onlyPromoterT7lacAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS97splitRBP_S2-Enz
Plasmid#183768PurposeExpresses SHIP2-Enzyme domain flanked by RBPDepositorInsertSHIP2 (INPPL1 Human)
Tags6HIS, RBP (C-terminal) HRV3C cleavage site, and R…ExpressionBacterialMutationincludes aa K414 to aa V872 onlyPromoterT7lacAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET24TEV-tSHIP2
Plasmid#183771PurposeExpresses C-terminal truncated SHIP2 (tSHIP2) with C-terminal TEV and 6HIS tags from pET24 backboneDepositorInsertSHIP2 (INPPL1 Human)
Tags6HIS and Tobacco Etch Virus (TEV) Cleavage siteExpressionBacterialMutationincludes aa18 to aa985 onlyPromoterT7 lacAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P RTEL1_1
Plasmid#160799PurposeSuppress RTEL1DepositorInsertshRTEL1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B CDC25A_2
Plasmid#160768PurposeSuppress CDC25ADepositorInsertshCDC25A_2
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P RTEL1_2
Plasmid#160800PurposeSuppress RTEL1DepositorInsertshRTEL1_2
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only