We narrowed to 27,307 results for: GFP
-
Plasmid#204575PurposeExpresses GFP-p62 var2 in mammalian cellsDepositorAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only
-
CB6-GFP-TAOK1
Plasmid#197108PurposeExpression of GFP-tagged TAOK1 / PSK2 in mammalian cellsDepositorAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorPublicationInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_Short_V5-GFP
Plasmid#221497PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an EF1a promoterDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pME-QUAS5x:GFPNLS-SV40pA
Plasmid#155115PurposeMiddle entry vector containing QUAS5x element upstream of GFP-NLS.DepositorInsertQUAS5x:GFPNLS
UseGateway middle entry vectorPromoterQUAS5x-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCKan-yibDp2-GFPuv
Plasmid#139083PurposeLow phosphate inducible promoter yibDp2 for GFP expressionDepositorInsertyibDp2-GFPuv
ExpressionBacterialAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-mROCK1-delta7
Plasmid#101295PurposeMammalian expression of Rock1-GFP for the study of localisation signaling.DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKin1A
Plasmid#31607DepositorAvailable sinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDECKO_GFP
Plasmid#141210Purposeempty GFP vector for cloning sgRNA or pgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab32b
Plasmid#140885PurposeExpression of zebrafish GFP-tagged Rab32b in mammalian cells.DepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS23·Pm-GFP
Plasmid#122593PurposeExpresses GFP under the regulatory control of Pm. Expression needs additional xyls geneDepositorInsertPm promoter
UseSynthetic BiologyExpressionBacterialPromoterPmAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-EGFP-ALDH1A1-Neo
Plasmid#189742PurposeThe construct was used to express GFP tagged human ALDH1A1 in mammalian cells for the analysis of the subcellular location of this protein.DepositorAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-P2A-EGFP
Plasmid#188898PurposeHuman lentiviral vector for expression of dCas9 with a C-terminal HA-2xNLS and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9
UseLentiviralTagsHA-2xNLS and P2A-GFPPromoterSFFVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CycK-GFP (1-270AA) in Cilantro (Codon optimized)
Plasmid#169930PurposeOverexpression of 1-270AA CycK-GFP fusionDepositorAvailable sinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable sinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Acceptor-Cas9-GFP
Plasmid#258802PurposeCRISPR vector with Cas9 and GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Acceptor-PuroR-GFP
Plasmid#258800PurposeCRISPR acceptor with PuroR and GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only