We narrowed to 5,259 results for: crispr cas9 grna plasmid
-
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_4
Plasmid#73536PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRL1
Plasmid#153997PurposesgRNA in vitro transcription plasmid.DepositorTypeEmpty backboneUseCRISPR; Sgrna under a t7 promoter for in vitro tr…PromoterT7Available SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
Plasmid#210709PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation moduleDepositorInsertSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
UseAAV and CRISPRExpressionMammalianMutationN55K in MCPPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only