We narrowed to 1,191 results for: CD2
-
Plasmid#223625PurposeLentiviral expression of human CD28 (Y191F) in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pHR-Spy-CD28
Plasmid#223622PurposeLentiviral expression of human CD28 with SpyTag003 in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD28-LgBiT
Plasmid#223616PurposeLentiviral expression of human CD28 with LgBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD28-CLIP
Plasmid#223610PurposeLentiviral expression of human CD28 with CLIP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-CLIP-CD28
Plasmid#223600PurposeLentiviral expression of human CD28 with CLIP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_RiboJ57-MCD2
Plasmid#204089PurposeType 0 RBS partDepositorInsertRiboJ57 ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_AraJ-MCD2
Plasmid#204088PurposeType 0 RBS partDepositorInsertAraJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_CchJ-MCD2
Plasmid#204087PurposeType 0 RBS partDepositorInsertCchJ ribozyme MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_ElvJ-MCD2
Plasmid#204086PurposeType 0 RBS partDepositorInsertElvJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_BydvJ-MCD2
Plasmid#204085PurposeType 0 RBS partDepositorInsertBydvJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_PlmJ-MCD2
Plasmid#204084PurposeType 0 RBS partDepositorInsertPlmJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_SarJ-MCD2
Plasmid#204083PurposeType 0 RBS partDepositorInsertSarJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-R_RiboJ-MCD2
Plasmid#204082PurposeType 0 RBS partDepositorInsertRiboJ ribozyme and MCD2 strong RBS
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-CD20-Puro
Plasmid#209755PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-PIP4K2CD280K
Plasmid#202737Purposeexpresses recruitable fluorescent protein-tagged enzymeDepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Cd247A_miR
Plasmid#163328PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only