We narrowed to 12,067 results for: 110
-
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3N
Plasmid#234614PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_3DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4N
Plasmid#234611PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_4DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250N, D262NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4V
Plasmid#234610PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to valineDepositorInserthnRNPA1_LCD_4DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250V, D262VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3V
Plasmid#234613PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to valineDepositorInserthnRNPA1_LCD_3DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol
Plasmid#232976PurposeGalactose iduced expression of Gcn4 solvvol in yeastDepositorInsertGcn4 solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
FAM177A1-Halo
Plasmid#224591PurposeFor expression of FAM177A1-Halo in mammalian cellsDepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0165 CMVTO-mono-hIL10 (R5A11M)-rens
Plasmid#231196PurposeCleaveIL-10DepositorInsertmono-hIL10 (R5A11M)-rens (IL10 Human)
ExpressionMammalianMutationN36I, N110I, K117N, F129LAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only