We narrowed to 17,698 results for: puromycin
-
Plasmid#184642PurposeRetroviral expression of mouse RAP1DepositorInsertRAP1
UseRetroviralTagsHAExpressionMammalianPromoterCMVAvailable sinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCIBN-rTetR (CIB1 Mustard Weed, Synthetic)
ExpressionMammalianMutationnonePromoterCMVAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8328 pLIX YAP1 S94A
Plasmid#184529PurposeExpression of YAP1 S94ADepositorAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPRKACA (PRKACA Human)
ExpressionMammalianMutationWTAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGSDMD (GSDMD Human)
ExpressionMammalianMutationWTAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.RAP1.delta.MYB
Plasmid#184660PurposeRetroviral expression of mouse RAP1 delta MYBDepositorInsertrap1
UseRetroviralTagsMYCExpressionMammalianMutationrap1 delta MYBPromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.RAP1.delta.COIL
Plasmid#184659PurposeRetroviral expression of mouse RAP1 delta COILDepositorInsertpLPC
UseRetroviralTagsMYCExpressionMammalianMutationrap1 delta COILPromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.RAP1.delta.BRCT
Plasmid#184658PurposeRetroviral expression of mouse Rap1 delta BRCTDepositorInsertRAP1
UseRetroviralTagsMYCExpressionMammalianMutationrap1 delta BRCTPromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.RAP1.delta.RCT
Plasmid#184661PurposeRetroviral expression of mouse RAP1 delta RCTDepositorInsertrap1
UseRetroviralTagsMYCExpressionMammalianMutationrap1 delta RCTPromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-TUBA1B_sgRNA
Plasmid#183889PurposepX459V2.0-HypaCas9 plasmid with TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B sgRNA spacer (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B sgRNA spacer (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRHOA sgRNA spacer (RHOA Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYJ34-PB-CRISPR-BANCR-E1-gRNA
Plasmid#131077Purposelong non-coding RNA BANCR knock outDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBANCR Exon1 gRNA (BANCR Human)
UseCRISPRExpressionMammalianAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
Plasmid#164471PurposeExpresses sgRNA targeting human GJA1 locusDepositorAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJPF0190
Plasmid#130268PurposePiggybac vector for the expression of mRuby2-fused human PRKACADepositorPublicationAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-CD74-ROS1 S1986F/L2000V
Plasmid#183818PurposeExpress CD74-ROS1 fusion (C6;R34) harboring ROS1 S1986F/L2000V mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianMutationS1986F/L2000VPromoterCMVAvailable sinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 S1986F/L2086F
Plasmid#183819PurposeExpress CD74-ROS1 fusion (C6;R34) harboring ROS1 S1986F/L2086F mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianMutationS1986F/L2086FPromoterCMVAvailable sinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only