We narrowed to 6,185 results for: cas9 expression plasmid

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#102807

Lentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Dec. 20, 2017

Academic Institutions and Nonprofits only

#102811

Lentiviral plasmid from FIRE-Cas9 system to express SS18-Frb fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Dec. 20, 2017

Academic Institutions and Nonprofits only

#246404

Cas9/sgRNA expression plasmid targeting PHF19

Yicheng Long

Much et al Mol Cell. 2025 Aug 7:S1097-2765(25)00615

Nov. 7, 2025

Academic Institutions and Nonprofits only

#58904

Cas9/gRNA Entry expression plasmid

Danwei Huangfu

Gonzalez et al Cell Stem Cell. 2014 Jun 11. pii: S1934-

Sept. 5, 2014

Academic Institutions and Nonprofits only

#102808

Lentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb1x fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Feb. 9, 2018

Academic Institutions and Nonprofits only

#102806

Lentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp1x fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Feb. 9, 2018

Academic Institutions and Nonprofits only

#102809

Lentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb2x fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Feb. 9, 2018

Academic Institutions and Nonprofits only

#102810

Lentiviral plasmid from FIRE-Cas9 system to express MS2-HP1cs fusion protein

Jerry Crabtree

Braun et al Nat Commun. 2017 Sep 15;8(1):560. doi: 1

Jan. 10, 2018

Academic Institutions and Nonprofits only

#98134

Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system

Hodaka Fujii

Fujita et al BMC Res Notes. 2018 Feb 27;11(1):154. do

March 16, 2018

Academic Institutions and Nonprofits only