We narrowed to 14,484 results for: SHR;
-
Plasmid#235469PurposeMessage phagemid carrying sgRNA4 (prom. J23110, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.5
Plasmid#235470PurposeMessage phagemid carrying sgRNA5 (prom. J23110, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p128Tol2-Olactb:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#226834PurposeExpression of b-actin driven Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterOlactb and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1022
Plasmid#228762PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Pkd2. Use for disruption of mouse Pkd2 in cultured cells.DepositorAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgTelo
Plasmid#227392PurposeAdhesion module, guide RNA recognizes telomeresDepositorInsertguide RNA targeting telomeres
UseLentiviralAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only