We narrowed to 24,948 results for: Spr
-
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMJ114
Plasmid#85995PurposeOne-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant regionDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified bovine U6-2Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆)
Plasmid#154840PurposeInsertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.DepositorInserthomology arm:rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆
UseCRISPR and Cre/LoxExpressionWormMutationHYGR∆ encodes aa 1-226Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -2
Plasmid#180009PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCC_02 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9NG-NLS-2A-Puro-WPRE
Plasmid#139087PurposeExpresses human codon-optimized Cas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationL1111R, D1135V,G1218R, E1219F, A1322R, R1335V, T1…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HA_mCherry-NLS
Plasmid#178209PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HA and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria1
Plasmid#124853PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP
Plasmid#155307PurposeRfx Cas13d guide cloning lentiviral vector with constitutively expressed puromycin resistance 2A-tagged with tagBFPDepositorInsertRfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
UseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX552-hsyn DIO GCaMP8f(with gRNA scaffold)
Plasmid#199580PurposeExpresses GCaMP8f in a Cre-dependent mannerDepositorInsertHis-DIO GCaMP8f
UseAAV, CRISPR, and Cre/LoxTags6xHisExpressionMammalianPromoterhsynAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only