We narrowed to 24,948 results for: Spr
-
Plasmid#179442PurposeDonor vector to knock in mScarlet-I C-terminal to human CRY1 geneDepositorInsertmScarletI
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC_09 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9-NLS-2A-Puro-WPRE
Plasmid#139094PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT100
Plasmid#180512PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
YET1000: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X4)
Plasmid#104571PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to four DmrA domainsDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to four DmrA domains
UseCRISPRTagsNLS-3xHA-3xFLAG-4xDmrAExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagng14aa
Plasmid#106439PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-PE
Plasmid#162796PurposeAll-in-one prime editor piggyBac transposonDepositorInsertSpCas9_ H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianPromoterCAGAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-T2A-GFP
Plasmid#193781PurposeTricistronic expression of dCas9-EGFP-BSDDepositorInsertdead Cas9
UseLentiviralTagsFLAGExpressionMammalianPromoterIn frame with existing Cas9 promoterAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
(564) pAAV Alb-AAT KRAB-SadCas9 U6-mPcsk9
Plasmid#163025PurposeExpression of CRISPRi with gRNA against mouse Pcsk9DepositorInsertMammalian codon-optimized SadCas9 (Pcsk9 S. aureus)
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-117G-hyeA3A-BE4max
Plasmid#157946PurposeLentiviral expression of hyeA3A-BE4maxDepositorInsertLenti -117G-hyeA3A-BE4max
UseCRISPR and LentiviralExpressionMammalianMutationN57GAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT527
Plasmid#180514PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, mNeonGreen, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
R711-X12-566: His6-MBP-tev-Hs.NF1iso2 (1203-1530)
Plasmid#159580PurposeE. coli protein expression of His6-MBP-tev-Hs.NF1iso2 (1203-1530)DepositorAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-117G-hyA3A-BE4max
Plasmid#157945PurposeLentiviral expression of hyA3A-BE4maxDepositorInsertLenti-117G- hyA3A-BE4max
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only