We narrowed to 11,848 results for: NSI
-
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) D332A Q345A N349A
Plasmid#229716PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, D332A Q345A N349AAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 2xFLAG-2xSTREP-KEAP1 (human)
Plasmid#236422Purposetransient overexpression of KEAP1 in mammalian cellsDepositorInsertKEAP1 (KEAP1 Human)
ExpressionMammalianAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 QFR IP3R3
Plasmid#236454Purposetransient overexpression of IP3R3 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 K-RAS 4A
Plasmid#236451Purposetransient overexpression of K-RAS 4A in mammalian cellsDepositorInsertK-RAS 4A (KRAS Human)
ExpressionMammalianAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG Fbxw7gamma
Plasmid#236471Purposetransient overexpression of FBXW7gamma in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Step-FLAG FBXO21
Plasmid#236458Purposetransient overexpression of FBXO21 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Strep-FLAG KBP
Plasmid#236459Purposetransient overexpression of KBP in mammalian cellsDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX.(Cyto)iGlucoSnFR.H66A.L276V-mRuby2
Plasmid#238943PurposeGreen glucose sensor with mRuby2 fusion, high sensitivity, cytosolicDepositorInsertiGlucoSnFR.L276V.K312A
UseLentiviralTagsMyc-mRuby2ExpressionMammalianPromoterCMVAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-Δhel1/Δhel2HRI-GFP-IRES-mCherry
Plasmid#226101PurposeHRI stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cellsDepositorInsertHRI (EIF2AK1 Human)
TagsGFPExpressionMammalianMutationSIFI degron helices 1 & 2 deleted (Δ61-112)Available SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-N-HRI(1-138)-GFP-IRES-mCherry
Plasmid#226100PurposeHRI N-terminal region (residues 1-138) stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VcnTS-E1015A-E1021A
Plasmid#213411PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A), in lentiviral expression vector.DepositorInsertVcnTS-E1015A-E1021A (VCL Synthetic, Chicken)
UseLentiviralMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Parkin(C431N)-A92mKO2
Plasmid#213545PurposeTransient mammalian expresssion of ligase-dead C431N Parkin, internally tagged with mKO2DepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K363TAG)
Plasmid#182661PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K363 & an N-terminal FLAG tag (DYKDDDDK) in mammalian cells. Can be used for genetic code expansion & click labeling of NFL.DepositorInsertmouse neurofilament light chain with a K363TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK363TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1cdN243-C1
Plasmid#131838PurposeExpresses the last 50 amino acids of HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a deletion contruct of the cytoplasmic m…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPMMLF1nes-C1
Plasmid#131849PurposeExpresses the N-terminal nuclear export signal of HcRed-NPMMLF1 in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a control deletion contruct of the cytop…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGB_3alpha2 OplacI:mini35S:RDF:Tnos (GB1534)
Plasmid#160617PurposeTU for the regulated expression of the PhiC31 phage recombination directionality factor (RDF) gene driven by a synthetic promoter consisting of the LacI operator fused to the minimal 35S promoter.DepositorInsertRDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha2 OplexA:mini35S:PhiC31int:Tnos (GB1529)
Plasmid#160614PurposeTU for the regulated expression of the PhiC31 phage integrase gene driven by a synthetic promoter consisting of the LexA operator fused to the minimal 35S promoter.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only