We narrowed to 11,535 results for: Kars
-
Plasmid#139127Purposeexpress FUS LC with hnRNPA2-like charge patterning where all R are changed to KDepositorInsertFUS (FUS Human)
ExpressionBacterialMutationAdd K and D to FUS LC so it has the same charge p…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCOrev
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-Lyn-AktAR2
Plasmid#125197PurposeSB-transposon plasmid for stable expression of lipid raft-targeted Lyn-AktAR2 variant of FRET-based AKT activity reporterDepositorInsertLyn-AktAR2
UseTransposonTagsLyn tag (GCIKSKRKD), mCerulean3 and cpVenus[E172]ExpressionMammalianPromoterEF1a/RPBSAAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PHF21A__CAMK1D
Plasmid#116831PurposeLentiviral expression of PHF21A__CAMK1D fusionDepositorInsertPHF21A__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PRKCE__CAMKMT
Plasmid#116832PurposeLentiviral expression of PRKCE__CAMKMT fusionDepositorInsertPRKCE__CAMKMT
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTK2__NCR3
Plasmid#116834PurposeLentiviral expression of PTK2__NCR3 fusionDepositorInsertPTK2__NCR3
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only