We narrowed to 19,455 results for: Kin
-
Plasmid#201627PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTPI1 (TPI1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro SHP2 D61A
Plasmid#8330DepositorInsertSHP2 (PTPN11 Human)
UseRetroviralTagsExpressionMammalianMutationD61A (activated mutant)PromoterAvailable sinceJune 23, 2005AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-S305A-3xFLAG
Plasmid#69839PurposeThis plasmid encodes PLK4 isoform 1 carrying an S305A mutation with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
UseTags3xFLAG tag and EGFPExpressionMammalianMutationS305APromoterCMVAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBMN HA-GBRP
Plasmid#89296PurposeFor expression of the mammalian Atg8 protein GABARAP tagged with HADepositorInsertGABARAP (GABARAP Human)
UseRetroviralTagsHAExpressionMammalianMutationPromoterAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
inhibin-DsRed
Plasmid#156184PurposeExpression plasmid for production of transgenic rainbow trout strain carrying the DsRed gene under control of the inhibin α promoter.DepositorInsertsrainbow trout inhibin α promoter
rainbow trout β actin 3'UTR
UseTagsExpressionBacterialMutationPromoterinhibinAvailable sinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21b GFP-Rab10 Q68LHis
Plasmid#186015PurposeGFP-Rab10 Q68LHisDepositorInsertGFP-Rab10 Q68LHis (RAB10 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual_GST-TEV-EGFP-TBK1
Plasmid#187830PurposePlasmid for the expression and purification of GST-TEV-EGFP-TBK1 in Spodoptera frugiperda cells (Sf9). Internal reference: SMC1631DepositorInsertTBK1 (TBK1 Human)
UseTagsGST and TEV-mEGFP-GG LinkerExpressionBacterial and InsectMutationPromoterAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-mGnptg
Plasmid#78106PurposeMammalian expression of mouse Gnptg with C-terminal His tagDepositorInsertGnptg (Gnptg Mouse)
UseTagsHisExpressionMammalianMutationPromoterCMVAvailable sinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NGAT(A193T,N194Y)
Plasmid#11388DepositorInsertgolgi associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1 Human)
UseTagsYFPExpressionMammalianMutationChanged Alanine 193 to Threonine, and Asparagine …PromoterAvailable sinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hMeCP2-GFP-R270X
Plasmid#48079PurposeMammalian expression of GFP tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
UseTagsGFPExpressionMammalianMutationexpresses AT-Hook R270XPromoterCMVAvailable sinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-SOCS6-WT
Plasmid#74496PurposeOverexpression of SOCS6 in mammalian cellsDepositorInsertSOCS6 (Socs6 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterunknownAvailable sinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-LAT Y6F YYYY-LAT YYYY -mCitrine (XSB588)
Plasmid#78516PurposeLentiviral vector for expressing LAT-Y6F YYYY-LAT-YYYY-mCitrine (3x2 Grb2 binding sites)DepositorInsertLAT (LAT Human)
UseLentiviralTagsmCitrineExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Cx32-7
Plasmid#54054PurposeLocalization: Gap Junctions, Excitation: 487, Emission: 509DepositorInsertCx32 (GJB1 Human)
UseTagsmEmeraldExpressionMammalianMutationPromoterCMVAvailable sinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRK5 Fyn deltaSH3
Plasmid#16034DepositorInsertc-Fyn (FYN Human)
UseTagsExpressionMammalianMutationDelta SH3: deletion of amino acids 76-141PromoterAvailable sinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMX-IY LC3C
Plasmid#89292PurposeFor expression of the mammalian Atg8 protein LC3C without a tagDepositorInsertLC3C (MAP1LC3C Human)
UseRetroviralTagsIRES-YFPExpressionMammalianMutationPromoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiex PKC - Peptide 8 mCit mCer
Plasmid#83563PurposeExpresses a mCitrine-mCerulean FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the EGF receptor.DepositorInsertPRKCA (PRKCA Human)
UseTags10 nm ER/K Helix, FLAG purification tag, TEV Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable sinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOMA-T679A-NLS
Plasmid#118938PurposeUsed to express the T679A mutant form of the SOMA FRET sensor with a nuclear localization signal in Arabidopsis thalianaDepositorInsertSOMA Sensor for Arabidopsis MAPK activity with T679A Mutation and Nuclear Localization Signal
UseTagsExpressionPlantMutationPromoterAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only