We narrowed to 29,073 results for: Tat
-
Plasmid#40985DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pBABEpuro-ERBB2 E321G
Plasmid#40981DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-L755_T759delLRENT
Plasmid#116339PurposeLentiviral expression of ERBB2 L755_T759delLRENTDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-G776delinsVC
Plasmid#116331PurposeLentiviral expression of ERBB2 G776delinsVCDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-R678Q
Plasmid#116347PurposeLentiviral expression of ERBB2 R678QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-R130Q
Plasmid#116631PurposeLentiviral expression of PTEN R130QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C334S
Plasmid#40983DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-V777_G778insGSP
Plasmid#116357PurposeLentiviral expression of ERBB2 V777_G778insGSPDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-L841V
Plasmid#116341PurposeLentiviral expression of ERBB2 L841VDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB2-T862A
Plasmid#116354PurposeLentiviral expression of ERBB2 T862ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MAP2K4-G294E
Plasmid#116430PurposeLentiviral expression of MAP2K4 G294EDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-G60R
Plasmid#116643PurposeLentiviral expression of PTPN11 G60RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-Y336*
Plasmid#116638PurposeLentiviral expression of PTEN Y336*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-E139D
Plasmid#116640PurposeLentiviral expression of PTPN11 E139DDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-T73I
Plasmid#116647PurposeLentiviral expression of PTPN11 T73IDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-D24G
Plasmid#116619PurposeLentiviral expression of PTEN D24GDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-R173C
Plasmid#116632PurposeLentiviral expression of PTEN R173CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C315S
Plasmid#40986DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C338S
Plasmid#40987DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C331S
Plasmid#40989DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRP[CRISPR]-EGFP/Puro-hCas9-U6>(long left)-U6>(long right)
Plasmid#216871PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, gRNA Long.L, gRNA Long.R (Dmd Mouse)
UseCRISPRMutationmdx mutation in mouse dystrophinAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-11NS-GFP
Plasmid#205181PurposeExpresses rat CENP-O with 11 mouse-specific point mutations in residues under positive selection; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationRat CENP-O with 11 mouse-specific point mutations…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-298-5NS-GFP
Plasmid#205742PurposeExpresses chimeric rat CENP-O with mouse CENP-O C-terminal RWD domain and 5 mouse-specific point mutations; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O C-terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BRAF-REG-T241P-Halo
Plasmid#202549PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag. The REG domain contains the RASopathy mutation, T241P, within its cysteine-rich domain.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
TagsHaloTagExpressionMammalianMutationThreonine 241 mutated to prolinePromoterCMVAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD 3E@3R
Plasmid#188149PurposeExpresses C-terminal flag-tagged human CAD 3E@3R in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R1398A A1400E R1403A R1404A L1405A
Plasmid#188138PurposeExpresses C-terminal flag-tagged human CAD R1398A A1400E R1403A R1404A L1405A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-G60A)
Plasmid#176144PurposeEGFP fused to the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Gly60Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Gly60 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-R65A)
Plasmid#176143PurposeEGFP fused the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Arg65Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Arg65 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-PolB-(K35A/K68A/K72A)-PAMmut-Hygro
Plasmid#176089PurposeEGFP fused the N-terminus of POLB containing the mutations Lys35Ala, Lys68Ala, and Lys72Ala, a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutations in Lys35 to Ala, Lys68 to Ala, and Lys7…PromoterCMVAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-N58K
Plasmid#116645PurposeLentiviral expression of PTPN11 N58KDepositorAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-E69K
Plasmid#116641PurposeLentiviral expression of PTPN11 E69KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTPN11-V51A
Plasmid#116648PurposeLentiviral expression of PTPN11 V51ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-R233*
Plasmid#116633PurposeLentiviral expression of PTEN R233*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-R335*
Plasmid#116634PurposeLentiviral expression of PTEN R335*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-S170N
Plasmid#116635PurposeLentiviral expression of PTEN S170NDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-V166Sfs*14
Plasmid#116636PurposeLentiviral expression of PTEN V166Sfs*14DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-Y27D
Plasmid#116637PurposeLentiviral expression of PTEN Y27DDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-L247_P248delLP
Plasmid#116624PurposeLentiviral expression of PTEN L247_P248delLPDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN-L247Sfs*6
Plasmid#116625PurposeLentiviral expression of PTEN L247Sfs*6DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only