We narrowed to 10,601 results for: yeast
-
Plasmid#60398PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta2 tubulin Cterminal tail (TUBB2a) C127S, E435C for crosslinking polyglutamate peptideDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB4a Cterminal tail C127S, E435C
Plasmid#60405PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta4a tubulin Cterminal tail (TUBB4a) C127S, E435C for crosslinking polyglutamate peptideDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoSuperfolderGFP-Kan
Plasmid#44901PurposeYeast tagging vector to create gene fusion with yeast optimized SuperfolderGFP with Kan selectionDepositorInsertyoSuperfolderGFP
ExpressionYeastAvailable SinceMay 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-neoCV
Plasmid#73889Purposefission yeast drug selection markerDepositorInsertneoCV
ExpressionBacterial, Mammalian, and Y…PromoterCMVAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomKate2-CaURA3
Plasmid#44878PurposeYeast tagging vector to create gene fusion with yeast optimized mKate2 with CaUra3 selectionDepositorInsertyomKate2
ExpressionYeastAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-zeoCV
Plasmid#73890Purposefission yeast drug selection markerDepositorInsertzeoCV
ExpressionBacterial, Mammalian, and Y…PromoterCMVAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TID-HA3-HIS3MX6
Plasmid#227981PurposeTo insert biotin ligase, TurboID, at the C-terminus of genes; yeast BioID, HIS3MX6 markerDepositorInsertTurboID
TagsHA tagExpressionYeastAvailable SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoEGFP-Kan
Plasmid#44900PurposeYeast tagging vector to create gene fusion with yeast optimized EGFP with Kan selectionDepositorInsertyoEGFP
ExpressionYeastAvailable SinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomTagBFP2-Kan
Plasmid#44899PurposeYeast tagging vector to create gene fusion with yeast optimized mTagBFP2 with Kan selectionDepositorInsertyomTagBFP2
ExpressionYeastAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pG1
Plasmid#162602PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yAT1.03
Plasmid#132781PurposeFRET biosensor for ATP measurements in budding yeastDepositorInsertyAT1.03 ymTq2-tdTomato
ExpressionYeastAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomCherry-Kan
Plasmid#44903PurposeYeast tagging vector to create gene fusion with yeast optimized mCherry with Kan selectionDepositorInsertyomCherry
ExpressionYeastAvailable SinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTPGI_dCas9_VP64
Plasmid#49013Purposeencodes yeast-optimized dCas9_VP64 synthetic transcription factorDepositorInsertdCas9_VP64 (codon-optimized for expression in S. cerevisiae)
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionYeastPromoterpTPGI (galactose+aTc inducible)Available SinceJan. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFS461
Plasmid#89064Purposeleu1 integration plasmid with adh1pr:Z3EVDepositorInsertZ3EV artificial transcription factor
UseLeu1 integrating vectorPromoteradh1Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomRuby2-Kan
Plasmid#44953PurposeYeast tagging vector to create gene fusion with yeast optimized mRuby2 with Kan selectionDepositorInsertyomRuby2
ExpressionYeastAvailable SinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoEGFP-CaURA3
Plasmid#44872PurposeYeast tagging vector to create gene fusion with yeast optimized EGFP with CaUra3 selectionDepositorInsertyoEGFP
ExpressionYeastAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomTagBFP2-SpHis5
Plasmid#44839PurposeYeast tagging vector to create gene fusion with yeast optimized mTagBFP2 with SpHis5 selectionDepositorInsertyomTagBFP2
ExpressionYeastAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomRuby2-SpHis5
Plasmid#44858PurposeYeast tagging vector to create gene fusion with yeast optimized mRuby2 with SpHis5 selectionDepositorInsertyomRuby2
ExpressionYeastAvailable SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWL89A mPing
Plasmid#145787PurposemPing Yeast Transposition AssayDepositorInsertmPing
ExpressionYeastMutationWTAvailable SinceJan. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits