We narrowed to 27,126 results for: GFP
-
Plasmid#61402PurposeExpresses GFP-tagged, PP1 binding-deficient Inhibitor-3 in mammalian cellsDepositorAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only
-
PCW57.1-ER-GshF-GFP
Plasmid#257607PurposeDoxycycline-inducible expression of ER-targeted GshF-GFPDepositorInsertER-GshF
ExpressionMammalianPromotertight TRE promoterAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-13bCTS-GFP
Plasmid#247243PurposeA bacterial expression plasmid encoding ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acid 1-346,364-428PromoterT7 PromoterAvailable SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-SET(1-218)
Plasmid#234707Purposeexpression of GFP in fusion with a C-terminally truncated SET proteinDepositorInsertSET (SET Human)
TagsAcGFPExpressionMammalianMutationexpresses only the N-terminal SET part (1-218)PromoterCMVAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
NFlhb-t2a-GFP
Plasmid#194357Purposeover expression vector for killifish lhb tagged with GFPDepositorInsertluteinizing hormone subunit beta
UseLentiviralTagst2a-GFPExpressionMammalianAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta69-97
Plasmid#124924PurposeFor expression of a.a.69-97 deletion mutant of SIN1-GFPDepositorAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin GFP
Plasmid#72921Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving GFPDepositorInsertviolet opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pClneoEGFPC-let60 K16N
Plasmid#66861PurposeExpress GFP-tagged dominat negative let60, in which Lysine 16 is mutated to asparagine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
TagsGFPExpressionMammalianMutationLysine 16 is mutated to asparaginePromoterCMVAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS305-mAID-LaM2
Plasmid#198413PurposeExpress mAID-Nb(LaM2) under the control of ADH1 promoter in budding yeastDepositorInsertmAID-Nb (LaM2)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Flag-ER-Hoxb8-IRES-GFP
Plasmid#222292PurposeLess commonly used plasmid for generating ER-Hoxb8 conditionally immortalized myeloid cell lines.DepositorUseRetroviralTagsFlagExpressionMammalianMutationThe estrogen receptor hormone binding domain cont…Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194715PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that can be cloned with BbsI sitesDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-KIF1Bbeta tail 387-1770
Plasmid#134620PurposeMammalian expression of mouse KIF1Bbeta 387-1170DepositorInsertKIF1Bbeta (Kif1b Mouse)
TagseGFPExpressionMammalianMutationWT with deletion of the 386 N-terminal residues.PromoterChicken Beta actinAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-APPL1-R146A/K152A/R154A
Plasmid#59767PurposeExpresses APPL1 Endosomal Localization MutantDepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NLS-mut
Plasmid#42000DepositorInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationR930A, R931A, R932A, R934APromoterCMVAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only