We narrowed to 7,880 results for: Lif
-
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53 QM
Plasmid#196268PurposeMammalian expression of 3xHA tagged p53 L25Q,Q26S,F53Q,F54SDepositorInsertTrp53 QM (Trp53 Mouse)
Tags3xHAExpressionMammalianMutationp53 L25Q,Q26S,F53Q,F54S mutantPromoterCMVAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-blast
Plasmid#167831PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19pps-EndoIV(Thermus Thermophilus)
Plasmid#236048PurposepET19pps-APE1(Thermus Thermophilus)DepositorInsertEndo IV from Thermus thermophilus
TagsHis tag and Histidine tagExpressionBacterialPromoterT7 RNA polymeraseAvailable SinceAug. 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS puro HA-hUSP27X Y381H
Plasmid#225723PurposeTransfection of USP27X (Y381H) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only