We narrowed to 28,961 results for: Tat
-
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop2
Plasmid#169832PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids R1398 - S1407; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1 and Loop2
Plasmid#169833PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 and F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletions of amino acids R1398 - S1407 and F1366 …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Allosteric Domain
Plasmid#169835PurposeExpresses C-terminal flag-tagged CAD with substitution of allosteric domain F1308 - C1455 with a (GGGS)X3 linkerDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationSubstitution of amino acids F1308 - C1455 with a …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(38))-PGKpuro2ABFP-W
Plasmid#200481PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(38) (CXCR4 Human)
UseLentiviralAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-R272Q
Plasmid#214911Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationR272Q substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-E80K
Plasmid#214910Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationE80K substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-80-GFP
Plasmid#205182PurposeExpresses chimeric rat CENP-O with mouse CENP-O N-terminus; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O N terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only