We narrowed to 78,117 results for: Rest
-
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_EDIL3
Plasmid#227957PurposeCo-localisation experimentDepositorAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr1
Plasmid#214682PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_TP73
Plasmid#214685PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_NC_chr1
Plasmid#214686PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_TP73
Plasmid#214687PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM.007
Plasmid#228693PurposeN terminal mRuby2 fluorescence tagDepositorInsertmRuby2
UseFluroscence tagMutationWTAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM.006
Plasmid#228692PurposeN terminal Venus fluorescence tagDepositorInsertVenus
UseFluroscence tagMutationWTAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM.005
Plasmid#228691PurposeN terminal mTurquoise2 fluorescence tagDepositorInsertmTurquoise2
UseFluroscence tagMutationWTAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_TMEM256
Plasmid#227955PurposeCo-localisation experimentDepositorAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_CBLN3
Plasmid#227950PurposeCo-localisation experimentDepositorAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TINGL-GR pDRF1
Plasmid#226437PurposeExpresses TINGL-RR (mTq2-based glucose sensor - O2A - ymNeongreen) in yeastDepositorInsertTINGL-O2A-ymNeongreen
ExpressionYeastPromoterPMA1Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
CPH3949_HIS-MBP-TEV-Tom1p-HECT-2850-3268
Plasmid#227089PurposeBacterial expression of HIS-MBP-TEV tagged Tom1p HECT domain (2850-3268)DepositorInserttom1p-HECT (TOM1 Budding Yeast)
TagsHIS-MBP-TEV_cleavage_siteExpressionBacterialPromoterT7Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
CPH3566_GST-TEV-Spt6p-tSH2-1223-1451
Plasmid#227085PurposeBacterial expression of GST-tagged Spt6 tSH2 domain (1223-1451)DepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only