We narrowed to 11,344 results for: cat.1
-
Plasmid#127195PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 QQ4xSS #2 (FUS Human)
TagshexahistidineExpressionBacterialMutationQQ4xSS #2:Q8S, Q9S, Q60S, Q62S, Q102, Q103, Q139S…Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-THROMBIN-GST
Plasmid#223764PurposeExpression of recombinant protein for purificationDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_NIX(1-182aa)-THROMBIN-GST (WT)
Plasmid#223733PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
TagsThrombin cleavage-GSTExpressionBacterialMutationaa 1-182 onlyAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_FUNDC1(1-50aa)-THROMBIN-GST (WT)
Plasmid#223734PurposeExpression of recombinant protein for purificationDepositorInsertFUNDC1 soluble part (FUNDC1 Human)
TagsThrombin cleavage-GSTExpressionBacterialMutationaa 1-50 onlyAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-188)-Venus
Plasmid#203714PurposeSPAX8-related truncated mutation (E189*) containing the amino acids 1 to 188 of human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (1-188) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 189-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-gp78 429-611
Plasmid#185354PurposeGST fusion protein for quantification of gp78 levelsDepositorAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgCasp8_#1-puro
Plasmid#231977PurposeKnockout mouse Casp8DepositorInsertsgRNA with Cas9 with puromycin resistance (Casp8 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST
Plasmid#223745PurposeExpression of recombinant protein for purificationDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-C-Flag-GK5 (1-287)
Plasmid#134262PurposeLentivector encoding Flag-tagged GK5 truncation (amino acids 1-287)DepositorInsertGk5 (Gk5 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationmouse Gk5 amino acids 1-287PromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKM343
Plasmid#71487PurposeContains loxP-hyg-cat-loxP cassette for recombineering; CamR, HygR.DepositorInsertloxP-hyg-cat-loxP
UseSource of loxp-hyg-cat- loxp for pcr amplificatio…ExpressionBacterialAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE zeo Ecotropic Receptor
Plasmid#10687DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP B56 alpha shRNA 6-3
Plasmid#10680DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGST-TEV-yVms1(1-417,delta(38-69))
Plasmid#128739PurposeBacterial overexpression and crystallizationDepositorInsertVms1 (VCP/Cdc48-associated mitochondria stress-responsive 1) (VMS1 Budding Yeast)
TagsGSTExpressionBacterialMutationresidues 1-417 with deletion of 38-69PromoterT7Available SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 AS 1-686 (N terminus deleted), Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-RPL3-1~41-mEGFP(A206K)-TwStrep
Plasmid#208628Purposefor E. coli expression of truncated human RPL3 (ENST00000216146), aa1~41, fused with mEGFP(A206K) and Twin Strep tagDepositorInserthuman RPL3 (ENST00000216146) aa 1~41 (RPL3 Human)
Tags6xHis, Twin Strep, and mEGFP(A206K)ExpressionBacterialMutationonly aa 1~41, other residues not includedPromoterT7Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-RPL3-1~77-mEGFP(A206K)-TwStrep
Plasmid#208624Purposefor E. coli expression truncated human RPL3 (ENST00000216146), aa1~77, fused with mEGFP(A206K) and Twin Strep tagDepositorInserthuman RPL3 (ENST00000216146) aa 1~77 (RPL3 Human)
Tags6xHis, Twin Strep, and mEGFP(A206K)ExpressionBacterialMutationonly aa 1~77, other residues not includedPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-CaMKKbeta rat 1-460 K193A
Plasmid#33326DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Rat)
TagsFLAGExpressionMammalianMutationtruncated at 460, K193A (S3V, G96R, and P108L als…PromoterSV40Available SinceApril 17, 2012AvailabilityAcademic Institutions and Nonprofits only