We narrowed to 43,031 results for: gats
-
Plasmid#184689PurposeLentiviral transfer plasmid for expression of ArgSen (-)NLSDepositorInsertArgSen (-)NLS
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-ArgSen
Plasmid#184691PurposeLentiviral transfer plasmid for expression of ArgSenDepositorInsertArgSen
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-ArgSen
Plasmid#184700PurposeLentiviral transfer plasmid for expression of ArgSenDepositorInsertArgSen
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYI047
Plasmid#170843Purpose(pFRO6::SMT2-FLAG::tOCS)DepositorInsertpFRO6::SMT2-FLAG
ExpressionPlantPromoterFRO6pAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYI048
Plasmid#170844Purpose(pGH3.17::SMT2-FLAG::tOCS)DepositorInsertpGH3.17::SMT2-FLAG
ExpressionPlantPromoterGH3.17pAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYI012
Plasmid#170841PurposepGH3.17::GUSPlus::tOCSDepositorInsertGH3.17p
ExpressionPlantPromoterGH3.17pAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT L1-Kozak-ERK-KTR-L2
Plasmid#186353PurposeEntry clone with ORF encoding ERK KTR flanked by Gateway recombination sequences. No Stop sequence: to be recombined into a destination vector with a C-terminal protein tag.DepositorInsertERK Kinase Translocation Reporter (MAPK1 Human, Synthetic)
UseProtein expressionAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST tol2 UbB polyA
Plasmid#188701PurposeGateway destination vector containing the zebrafish ubiquitin B polyadenylation sequenceDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-29
Plasmid#160219PurposeAtpU6-29 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-29 promoter
UseGolden gate level 0 piece to express grnasAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono3
Plasmid#73542PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono1
Plasmid#73543PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB106
Plasmid#185065PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion including C-terminal half of Nup1 C-terminal FG domainDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated so C-terminal h…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSub-Asp6-MBP-HRas
Plasmid#185758PurposeBacterial expression of Asp6-MBP-HRasDepositorInsertAsp6-MBP-HRas
TagsMBPExpressionBacterialMutation6x Asp added to the N terminus of MBPPromotertacAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-NegCon
Plasmid#183554PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)DepositorInsertLuciferase shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L1-dSpRY
Plasmid#177681PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L2-dSpRY
Plasmid#177682PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF-L2-dMb2Cas12a
Plasmid#177684PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dMb2Cas12a genome editingDepositorInsertFokI-dMb2Cas12a
UseCRISPR; Gateway compatible foki-dmb2cas12a entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xHA-Syn-smFP-flag
Plasmid#182563PurposeFor mouse Nav1.6 knockin with 3xHA at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xHA donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only