We narrowed to 6,951 results for: crispr cas9 plasmids
-
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgPLXNB2
Plasmid#86151PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPRAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only