We narrowed to 1,428 results for: aav vector plasmid
-
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls mir-122 1xBS
Plasmid#35643DepositorInsert1 miR-122 target site
UseAAVPromoterCBAvailable SinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
Plasmid#176282PurposeViral vector for co-expression of TeNT and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertTeNT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-scaffold (2xBsmBI sites)
Plasmid#120301PurposeAAV vector for expression of AcrIIC3 (no miR binding sites, control vector)DepositorInsertAcrIIC3
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-scaffold (2xBsmBI sites)
Plasmid#120300PurposeAAV vector for expression of AcrIIC1 (no miR binding sites, control vector)DepositorInsertAcrIIC1
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G88P3-HA-hM3Dq
Plasmid#213972PurposeAAV vector with G88P3 promoter that can drive robust gene expression in MSNsDepositorInserthM3D (Gq)
UseAAVPromoterG88P3Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA
Plasmid#216321PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-flex-ReaChR-citrine
Plasmid#50955Purposeflexed-ReaChR-citrine in AAV2 vector under human synapsin promoterDepositorInsertReaChR-citrine
UseAAVTagscitrinePromoterhuman synapsin promoterAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2-ChR2-mCherry
Plasmid#170845PurposeAAV vector for Cre-dependent transgene expression of ChR2-mCherry in cortical interneurons under the control of the Dlx enhancer.DepositorInsertChR2-mCherry
UseAAVExpressionMammalianPromoterDlxAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only