We narrowed to 46,018 results for: cha
-
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Nsp3 -mCherry
Plasmid#165131Purposemammalian expression and localizationDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-Cx43-GFP
Plasmid#176860PurposeExpresses Cx43 fused with GFP at the C-terminus in astrocytesDepositorAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nsp6-mCherry
Plasmid#165133Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ProteinC
Plasmid#242774PurposeAAV transfer plasmid expressing eGFP-ProteinC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsProteinCPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-Tag100
Plasmid#242779PurposeAAV transfer plasmid expressing eGFP-Tag100 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTag100PromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SPOT
Plasmid#242777PurposeAAV transfer plasmid expressing eGFP-SPOT under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSPOTPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-AU5
Plasmid#242765PurposeAAV transfer plasmid expressing eGFP-AU5 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsAU5PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-E2
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only