We narrowed to 45,012 results for: cha

#165139

mammalian expression and localization

Bruno Antonny

Miserey-Lenkei et al Biol Cell. 2021 Jul;113(7):311-328. doi:

March 2, 2021

Academic Institutions and Nonprofits only

#165126

mammalian expression and localization

Bruno Antonny

Miserey-Lenkei et al Biol Cell. 2021 Jul;113(7):311-328. doi:

Feb. 22, 2021

Academic Institutions and Nonprofits only

#110851

Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)

Lukas Dow

Zafra et al Nat Biotechnol. 2018 Jul 3. pii: nbt.419

June 27, 2018

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#139331

Plasmid expressing a sgRNA to introduce BRCA1 Q1779Stop using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#139328

Plasmid expressing a sgRNA to introduce BRCA1 T922I using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#183676

Recombinant Salmonella Typhimurium SopB

Sergio Grinstein

Walpole et al Nat Cell Biol. 2022 Apr 28. pii: 10.1038

May 3, 2022

Academic Institutions and Nonprofits only

#159168

Nuclear labile heme reporter

Amit Reddi

Hanna et al Proc Natl Acad Sci U S A. 2016 Jul 5;113

Sept. 29, 2020

Industry, Academic Institutions, and Nonprofits

#165127

mammalian expression and localization

Bruno Antonny

Miserey-Lenkei et al Biol Cell. 2021 Jul;113(7):311-328. doi:

March 2, 2021

Academic Institutions and Nonprofits only