We narrowed to 45,012 results for: cha

#76110

3rd generation lentiviral gRNA plasmid targeting human TRPM7

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#99623

To clone gene of interest downstream of FRT2-H2B-EGFP-V5-2A cassette

Rui Benedito

Pontes-Quero et al Cell. 2017 Aug 10;170(4):800-814.e18. do

Sept. 7, 2017

Academic Institutions and Nonprofits only

#76111

3rd generation lentiviral gRNA plasmid targeting human TRPM7

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#109378

Synaptic transmission

Adam Cohen

Adam et al Nature. 2019 May 1. pii: 10.1038/s41586-

May 2, 2019

Academic Institutions and Nonprofits only

#113871

expression of Cas9 programming sgRNA5 and sgRNA2 targetting HXT13-15-16 and HXT2 respectively

Jean-Marc Daran, Jack Pronk

Wijsman et al FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5

Sept. 5, 2018

Academic Institutions and Nonprofits only

#113873

expression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectively

Jean-Marc Daran, Jack Pronk

Wijsman et al FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5

Sept. 5, 2018

Academic Institutions and Nonprofits only

#113874

expression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectively

Jean-Marc Daran, Jack Pronk

Wijsman et al FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5

Sept. 5, 2018

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only