We narrowed to 1,562 results for: sgrna vector
-
Plasmid#241196PurposeMiddle entry vector for mini-Golden subcloning platform; mCherry; NTR-v2DepositorInsertmCherry; NTR-v2
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
T2A-mCherry-P2A-NTRv2-pA-ORF-2
Plasmid#241197PurposeMiddle entry vector for mini-Golden subcloning platform; mCherry; NTR-v2DepositorInsertmCherry; NTR-v2
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF3
Plasmid#241194PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF2
Plasmid#241193PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF1
Plasmid#241192PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
nAPEX2-V5-zdCas9n-3x-FLAG-GSG-linker-P2A-mNeongreen
Plasmid#241191PurposeMiddle entry vector for mini-Golden subcloning platform; 3x-FLAG; mNeongreenDepositorInsert3x-FLAG; mNeongreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
3x-FLAG-nzdCas9-V5-APEX2n-GSG-linker-P2A-mNeongreen
Plasmid#241190PurposeMiddle entry vector for mini-Golden subcloning platform; V5-APEX2n; mNeongreenDepositorInsertV5-APEX2n; mNeongreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2FE-ABE8e-SpRY
Plasmid#213008PurposeA lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning siteDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRExpressionMammalianPromoterPgkAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv4
Plasmid#221432PurposeLentiviral CRISPR/Cas9 vector for co-expression of sgRNAs and Cas9 protein.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HA_mCherry-NLS
Plasmid#178209PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HA and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa1-Cas9-GFP
Plasmid#208049PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRExpressionMammalianAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only