We narrowed to 46,018 results for: cha
-
Plasmid#99620PurposeTo clone gene of interest downstream of FRT2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT3-HA-H2B-Cerulean-2A (IG158))
Plasmid#99624PurposeTo clone gene of interest downstream of FRT3-HA-H2B-Cerulean-2A cassetteDepositorInsertHA-H2B-Cerulean
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-Puro
Plasmid#110852PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001145424)
Plasmid#76113Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pN1_FKBP-HsKIF1C(886-1103)-mCh
Plasmid#253322Purposemammalian expression of the IDR domain (aa 886-1103) of HsKIF1C tagged with FKBP and mCherry. The FKBP tag enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_FKBP-mCh-FTH1
Plasmid#253323Purposemammalian expression of human FTH1 tagged with FKBP and mCherry. FTH1 self-assembles into a 24-merparticle. FKBP enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_FKBP-HsKIF1C(349-1103)-mCh
Plasmid#253321Purposemammalian expression of the stalk+tail domains (aa 349-1103) of HsKIF1C tagged with FKBP and mCherry. The FKBP tag enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_HsKIF1C(1-376)-NC-LZ-TagBFP-FRB
Plasmid#253326Purposemammalian expression of the motor domain of human KIF1C tagged with TagBFP and FRB. NC and LZ facilitate stable dimerization. FRB enables rapamycin-induced attachment to FKBP-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-eGFP-HSV
Plasmid#242769PurposeAAV transfer plasmid expressing eGFP-HSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHSVPromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only