We narrowed to 4,936 results for: AAT
-
Plasmid#177232PurposeExpresses Sik1(bU6), Sik2 (mU6) and Sik3 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgSik1_1st/sgSik2/sgSik3_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PCNA
Plasmid#188686Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-TBRII-N-18
Plasmid#54273PurposeLocalization: Membrane Receptor, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
mEmerald-TBRII-C-18
Plasmid#54272PurposeLocalization: Membrane Receptor, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNuak1-hU6-sgNuak2
Plasmid#177234PurposeExpresses Neomycin (bU6), Nuak1 (mU6) and Nuak2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNuak1/sgNuak2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177230PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_2nd
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177227PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL41258_CP
Plasmid#245691PurposeLevel 0 Golden Gate Signal Peptide acceptor with AmilCP negative selection cassette AATG - AGGTDepositorTypeEmpty backboneUseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL41308_CP
Plasmid#245695PurposeLevel 0 Golden Gate Coding Sequence (WITH stop codon) acceptor with AmilCP negative selection cassette AATG - GCTTDepositorTypeEmpty backboneUseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12028
Plasmid#245635PurposeLevel 0 Golden Gate part pAt2: Rib Prot16 (At4g34620) promoter, GGAG - AATGDepositorInsertpAt2: Rib Prot16 (At4g34620) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12029
Plasmid#245636PurposeLevel 0 Golden Gate part pAt5: XET (At5g65730) promoter, GGAG - AATGDepositorInsertpAt5: XET (At5g65730) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL41295_CP
Plasmid#245694PurposeLevel 0 Golden Gate Promoter acceptor with AmilCP negative selection cassette GGAG - AATGDepositorTypeEmpty backboneUseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL01002_CP
Plasmid#245687PurposeLevel 0 Golden Gate N-terminal tag acceptor with AmilCP negative selection cassette CCAT - AATGDepositorTypeEmpty backboneUseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12080
Plasmid#245650PurposeLevel 0 Golden Gate part EC1.2-EN-EC1.1 Enhancer Fusion promoter, GGAG - AATGDepositorInsertEC1.2-EN-EC1.1 Enhancer Fusion promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12033
Plasmid#245638PurposeLevel 0 Golden Gate part RP27 Magnaporthe Fungal promoter, GGAG - AATGDepositorInsertRP27 Magnaporthe Fungal promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12007
Plasmid#245628PurposeLevel 0 Golden Gate part pAt3: Cysteine Synthase (At3g61440) promoter, GGAG - AATGDepositorInsertpAt3: Cysteine Synthase (At3g61440) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12001
Plasmid#245625PurposeLevel 0 Golden Gate part pAt4: AtPSBQ (At4g21280) promoter, GGAG - AATGDepositorInsertpAt4: AtPSBQ (At4g21280) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.25
Plasmid#246894PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for UBAP2L Nterm.DepositorInsertUBAP2L Nterm Guide RNA 1 (UBAP2L Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #1
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
ipUSEPR-sg-Hs-CDK1
Plasmid#188684Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_2nd-hU6-sgNT
Plasmid#177229PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_2nd/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_1st-mU6-sgNeo1-hU6-sgNT
Plasmid#177225PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_1st/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_1st-hU6-sgNT
Plasmid#177226PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_1st/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_2nd-mU6-sgNeo1-hU6-sgNT
Plasmid#177228PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_2nd/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_APL3
Plasmid#166073PurposePlasmid for constituive spCas9 and tet-inducible APL1-targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YNR071C
Plasmid#166081PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of YNR071C for double stranded break formation in yeast.DepositorInsertPromoter of YNR071C (YNR071C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_SLA1
Plasmid#166075PurposePlasmid for constituive spCas9 and tet-inducible SLA1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA A
Plasmid#127904PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GLT-1b delta 4
Plasmid#98707Purposemammalian expression of Glt1b delta 4 mutantDepositorInsertGlt1b (Slc1a2 Rat)
ExpressionMammalianMutationmissing last 4 amino acids at the C-terminus. I52…Available SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK581
Plasmid#71695PurposeProduces Acetobacter aceti 1023 thioredoxin with a C-terminal His6 tag and Cys35>Ser mutant (AaTrxAH6-C35S)DepositorInsertthioredoxin
TagsHis6ExpressionBacterialMutationchanges cysteine-35 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK558
Plasmid#71704PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with Cys138>Ser mutant (AaTrxB1-C138S)DepositorInsertthioredoxin reductase 1
ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only