We narrowed to 1,562 results for: sgrna vector
-
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
Plasmid#156431PurposeTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTGDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Pou5f1
Plasmid#174872PurposeCRISPR vector for generating Pou5f1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Pou5f1 (Pou5f1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.NWS.VSVg_NGFR
Plasmid#158348PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.S_mCherry-NLS
Plasmid#178224PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.Ollas_mCherry-NLS
Plasmid#178263PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.AU1.VSVg_NGFR
Plasmid#158351PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.HA.V5_mCherry-NLS
Plasmid#178283PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.VSVg.V5_mCherry-NLS
Plasmid#178236PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.S.VSVg_mCherry-NLS
Plasmid#178234PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g1 (BB34)
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.Ollas.VSVg_NGFR
Plasmid#158324PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.Ollas.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only