We narrowed to 6,812 results for: KIT;

#178725

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#172411

MAC-tagged gene expression

Markku Varjosalo

Liu et al Mol Syst Biol. 2021 Nov;17(11):e10396. d

Nov. 4, 2021

Industry, Academic Institutions, and Nonprofits

#228369

express human FBXL17 in insect cells, such as Trichoplusia ni Hi5

Ning Zheng

Cao et al Cell. 2024 Oct 30:S0092-8674(24)01188-7.

May 15, 2025

Academic Institutions and Nonprofits only

#236233

AAV expression of mouse STIM1 internally tagged with HaloTag

Jennifer Lippincott-Schwartz

Benedetti et al Cell. 2025 Jan 23;188(2):484-500.e22. do

May 2, 2025

Academic Institutions and Nonprofits only

#220592

Retroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffold

Russell Jones

Ma et al bioRxiv [Preprint]. 2023 Jun 11:2023.06.

Aug. 13, 2024

Academic Institutions and Nonprofits only

#202409

gRNA expression vector for DCK

Morito Kurata

Sugita et al Commun Biol. 2023 Jun 1;6(1):582. doi: 1

Oct. 2, 2023

Academic Institutions and Nonprofits only

#177363

Expresses human KIF1A(1-393)(P305L) fused with leucine zipper and His tag

Shinsuke Niwa

Anazawa et al Proc Natl Acad Sci U S A. 2022 Aug 9;119

Aug. 10, 2022

Academic Institutions and Nonprofits only

#178722

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178723

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only