We narrowed to 1,883 results for: sfGFP
-
Plasmid#217767PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
plenti.CamKII.(synapto).cpsfGFP.miRFP670nano3
Plasmid#214926PurposeExpresses presynaptic non-responsive controlDepositorInsert(synapto).cpsfGFP.miRFP670nano3
UseLentiviralExpressionMammalianPromoterCamKIIAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.(cyto).cpSFGFP.HaloTag
Plasmid#209666PurposeNon-responsive controlDepositorInsertcpSFGFP.HaloTag
UseAAVPromoterhSynAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSSCPG
Plasmid#183187PurposePACE-evolved split N (core) terminal of T7 RNA polymerase-SpmXΔC and SpmXΔC-PACE-evolved split C (sigma) terminal of T7 RNA polymerase both expressed under Tac promoter; sfGFP-LAA expressed under T7 pDepositorInsertssuperfolder GFP
SpmX450 and T7 181+ fusion protein
T7 RNAP 1-179 variant and SpmX450 fusion protein
mRFP1 and popZ fusion protein
ExpressionBacterialAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFNMB1-msfGFP
Plasmid#113191PurposeMobilizable plasmid for tetracycline inducible gene expression in Francisella novicidaDepositorInsertmsfGFP
Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB_EF1a-DjCas13d-msfGFP-Blast
Plasmid#226008PurposeDjCas13d protein for RNA targeting in piggyBac backboneDepositorInsertDjCas13d RNA-targeting nuclease
UseCRISPRTagsmsfGFPExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut
Plasmid#235588PurposeDox-inducible expression of control catalytic-mutant Setd2 CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
Plasmid#217766PurposeFluorescent reporter for ceramide (for bacterial expression and purification)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEVI(408)-ColE-iLight-msfGFP
Plasmid#170268PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.DepositorInsertiLight
TagsmsfGFPExpressionBacterialMutationTo design iLight for expression in bacteria, a fu…PromoterpJ23116Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_sfGFP150TAA
Plasmid#174897Purposeochre suppression reporter sfGFP150TAA expression, with MmaPylT(UUA) ochre suppressor tRNA cassetteDepositorInsertsf GFP
ExpressionMammalianMutation150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-vsfGFP-0
Plasmid#191097PurposeTo express a bright green nanobody FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-vsfGFP-0
UseAAVTagsGreen fluorescent protein bound to enhancer nanob…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP340 pEF1a-NLS-scFvGCN4-DNMT3a (mutant)
Plasmid#100944PurposeSingle chain variable fragment antibody GCN4 fused to DNMT3a catalytic mutant, binds SunTag, with 3xTy1 tagDepositorInsertscFvGCN4, sfGFP, GB1, DNMT3a catalytic mutant (DNMT3A Human, Synthetic)
Tags3xTy1ExpressionMammalianMutationF636A, E660A, E725A, R295AAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagng14aa
Plasmid#106439PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti ccdB sgRNA Hyg sfGFP
Plasmid#235048PurposeLentiviral sgRNA expression vector with hygromycin and superfolder GFP. Also contains ccdB cassette for library cloning.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-N22P-sfGFP-NLS
Plasmid#236389PurposeOverexpression of N22P-3xEGFP in human cellsDepositorInsertN22P-3xEGFP
UseLentiviralAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
LI D-E 1-10GFP
Plasmid#54452DepositorInsert16 aa GS linker + superfolder GFP 1-10 domain
UseCloning vectorAvailable SinceNov. 10, 2014AvailabilityAcademic Institutions and Nonprofits only