We narrowed to 6,915 results for: crispr cas9 plasmids

#130940

Engineered sgRNA-LEB3 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 8, 2019

Academic Institutions and Nonprofits only

#130964

Engineered sgRNA-LEB2 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 1, 2019

Academic Institutions and Nonprofits only

#130946

Engineered sgRNA-G6-2MS2 (2 MS2 aptamers) generator circuit including promoter Pbad

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 1, 2019

Academic Institutions and Nonprofits only

#130944

Engineered sgRNA-LEB5 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 1, 2019

Academic Institutions and Nonprofits only

#130943

Engineered sgRNA-LEA5 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 1, 2019

Academic Institutions and Nonprofits only

#130939

Engineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 1, 2019

Academic Institutions and Nonprofits only

#130941

Engineered sgRNA-LEA4 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Sept. 26, 2019

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#155088

lentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locus

Jason Moffat

Aregger et al Nat Metab. 2020 Jun;2(6):499-513. doi: 1

Aug. 7, 2020

Academic Institutions and Nonprofits only

#155085

lentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locus

Jason Moffat

Aregger et al Nat Metab. 2020 Jun;2(6):499-513. doi: 1

Aug. 7, 2020

Academic Institutions and Nonprofits only