We narrowed to 4,386 results for: ARA-2
-
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmHPat-del57-499-dsRNAres_J
Plasmid#146691PurposeInsect Expression of DmHPat-del57-499-dsRNAresDepositorInsertDmHPat-del57-499-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationone silent mutation A1758G compared to the sequen…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmHPat-dsRNAres_J
Plasmid#146692PurposeInsect Expression of DmHPat-dsRNAresDepositorInsertDmHPat-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationtwo non silent, A479V, G568D and one silent mutat…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat-del500-684-dsRNAres_H
Plasmid#146466PurposeInsect Expression of DmHPat-del500-684-dsRNAresDepositorInsertDmHPat-del500-684-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationtwo silent mutations compared to the sequence gi…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH015
Plasmid#80398PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-GFP(3xFLAG). Used for Western blotsDepositorUseSynthetic BiologyTagsC-terminal 3xFLAG tag and C-terminal LZx domainExpressionBacterialAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha11_SulR
Plasmid#186424Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assemblyDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBG-ttLbUV2
Plasmid#231386PurposeLbCas12a variant with D156R and E795L mutations and harboring same NLS sequence as PEmax but codon-optimized for dicot species; for Agrobacterium-mediated Arabidopsis transformation.DepositorInsertttLbCas12a Ultra V2
UseCRISPRExpressionPlantMutationD156R and E795LAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G
Plasmid#52473PurposeExpresses splitTVA-EGFP-B19GDepositorHas ServiceAAV1InsertTVA-P2A-EGFP-P2A-B19G
UseAAV and Cre/LoxExpressionMammalianPromoterSynapsin-1Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCherry-7aa-ActA-pEGFP-C1
Plasmid#177406PurposeTo express mCherry fused to mitochondria outer membrane targeting sequence "ActA". mCherry faces the cytosol.DepositorInsertActA tail anchor (actA Listeria monocytogenes)
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:AtFLS2
Plasmid#202186PurposeExpress Arabidopsis thaliana FLS2 gene under UBQ10 promoterDepositorAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
7M8
Plasmid#64839PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the 7M8 capsid protein.DepositorInsert7M8 cap
UseAAVMutation7mer insertion in the AAV2 capAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 136X
Plasmid#11049DepositorInsertHRPT2 136X (CDC73 Human)
TagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 227X
Plasmid#11050DepositorInsertHRPT2 227X (CDC73 Human)
TagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-RaichuEV-Rac1(T17N)
Plasmid#164902PurposeExpresses a Rac1 FRET sensor RaichuEV-Rac1 which contains a dominant negative mutation T17N in the Rac1 domainDepositorInsertRaichuEV-Rac1 (RAC1 Human)
ExpressionMammalianMutationT17N mutation in the Rac1 domain which make the s…Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-His8-aCat(660-906)
Plasmid#203333PurposeBacterial expression of alpha-catenin F-actin binding domainDepositorInsertCTNNA1 (CTNNA1 Human)
Tags8xHis with precision protease cleavage siteExpressionBacterialMutationaa 660-906 onlyAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-His8-aCat(660-865)
Plasmid#203335PurposeBacterial expression of alpha-catenin F-actin binding domainDepositorInsertCTNNA1 (CTNNA1 Human)
Tags8xHis with precision protease cleavage siteExpressionBacterialMutationaa 660-865 onlyAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-His8-aCat(660-885)
Plasmid#203334PurposeBacterial expression of alpha-catenin F-actin binding domainDepositorInsertCTNNA1 (CTNNA1 Human)
Tags8xHis with precision protease cleavage siteExpressionBacterialMutationaa 660-885 onlyAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro-ARHGAP26
Plasmid#69467PurposeExpresses ARHGAP26DepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only