We narrowed to 370 results for: gag pol
-
Plasmid#22500DepositorInsertgag, pol, tat, rev
ExpressionMammalianAvailable SinceMarch 12, 2010AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_6_002
Plasmid#167348PurposeddPCR gating control for droplets containing either gag+5'pol targets OR 3'pol+tat targetsDepositorInsertpol_gag_tat
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8.91
Plasmid#187441PurposeLentiviral packaging plasmid expressing gag and pol.DepositorInsertsUseLentiviralAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-CD8a/d2eGFP-IRES-Nef
Plasmid#126552PurposeReplication incompetent HIV with H13L Tat and d2eGFP/CD8a reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsCD8a and GFPMutationDelta gag/polPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCD/NL-BH*deltavpu/RT-
Plasmid#136985PurposeSecond-generation lentiviral packaging plasmid lacking reverse transcriptase activityDepositorInsertHIV-1 Gag, Pol (Integrase), Tat, Rev, Vpr, Vif
ExpressionMammalianMutationcarries D110E mutation in the reverse transcripta…Available SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CTE-Luc
Plasmid#60881PurposeReporter construct to study unspliced RNA export. Coding sequence of luciferase gene was sandwiched between 5' and 3' splice site sequences originating from the HIV gag/pol gene followed by CTEDepositorInsertLuc-CTE
ExpressionMammalianAvailable SinceJan. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSIV-D3psi/delta env/delta Vif/delta Vpr
Plasmid#132928PurposeProduction of SIV-VLPs containing Vpx proteinDepositorInsertGag, pol, and vpx
UseLentiviralAvailable SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
HIV-1 LTR-gfp
Plasmid#115809PurposeHIV-1 LTR driven reporter vector that retains complete LTRs, tat, and rev, but has a frameshift mutation in env, an ngfr reporter gene in place of nef, and gfp in place of gag, pol, vif, and vprDepositorInsertgfp and ngfr
UseLentiviralPromoterHIV1 LTRAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only