We narrowed to 13,889 results for: mpl
-
-
pcDNA5-FRT-TO-Nsp10-HF
Plasmid#157708Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp10 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-moxGFP-Zeo-H2BC11
Plasmid#207759PurposeDonor template for moxGFP-2A-Zeo insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a moxGFP-Zeo Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-Hygro-EF1A-WWE-Linker-eGFP
Plasmid#176072PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertWWE
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 MP1 shRNA
Plasmid#26632DepositorAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13
Plasmid#157712Purposemammalian expression of untagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-Hygro-EF1A-FHA-Linker-eGFP
Plasmid#176065PurposeEGFP fused to the C-terminus of a FHA domain & a hygromycin resistance cassetteDepositorInsertFHA
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_del321-343
Plasmid#98676PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with a deletion of AA 321-343DepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
hRAD18 dSAP-EGFP
Plasmid#68825PurposeExpresses human RAD18 (deleting SAP domain) tagged with EGFPDepositorInserthuman RAD18 (deleting SAP domain) tagged with EGFP (RAD18 Human)
ExpressionMammalianAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only
