We narrowed to 24,053 results for: Sis
-
Plasmid#87030PurposeTag S. pombe genes in C terminal with mEOS3.2DepositorInsertmEOS3.2
ExpressionBacterial and YeastAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-yfp
Plasmid#227641PurposeNegative control plasmid encoding yfp downstream of an attenuated ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertyfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-3HA::FRB::3HA
Plasmid#247588PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xHA
UseUnspecifiedPromoterread throughAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-3Ty:mNG:3Ty
Plasmid#179800PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGM53151
Plasmid#169093PurposeLevel 1 cloning vector for transient expression. Already contains the 35S promoter and the Nos terminator.DepositorTypeEmpty backboneUseMoclo cloning vectorExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS24·Pm-GFP
Plasmid#122594PurposeExpresses GFP under the regulatory control of Pm. Expression needs additional xyls geneDepositorInsertPm promoter
UseSynthetic BiologyExpressionBacterialPromoterPmAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTdTomato-L5
Plasmid#140994PurposetdTomato, StrepR, L5int, attP to create RFP mycobacteriaDepositorInserttdTomato
ExpressionBacterialPromoterhsp60Available SinceOct. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC70188
Plasmid#209449PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC-mCherryFP-GFP
Plasmid#129102PurposemCherryFP positive controlDepositorInsertmCherryFP
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2019AvailabilityAcademic Institutions and Nonprofits only