pTdTomato-L5
(Plasmid #140994)

• Purpose: tdTomato, StrepR, L5int, attP to create RFP mycobacteria
• Depositing Lab: Wilbert Bitter
• Publication: Meijers et al Tuberculosis (Edinb). 2020 Sep;124:101983. doi: 10.1016/j.tube.2020.101983. Epub 2020 Aug 12.

Backbone

• Vector backbone: pMV361-strep
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdTomato
• Species: Discosoma
• GenBank ID: AAV52169
• Promoter: hsp60

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: GGCTTCTTGCACTCGGCATA

Resource Information

• Supplemental Documents:
  • pTdTomato-Strep-L5.gb
• A portion of this plasmid was derived from a plasmid made by: tdTomato: Alex Speer pMV261-strep: Vincent van Winden
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

tdTomato: Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein
Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry

(2004). Nature Biotechnology, 22(12) , 1567-1572. doi: 10.1038/nbt1037.