We narrowed to 10,494 results for: nar
-
Plasmid#121874PurposepMVP destination vector, empty PiggyBac transposon vector backbone w/ Puro selection cassetteDepositorTypeEmpty backboneUsePiggybac transposon, pmvp gateway destination vec…TagsExpressionMammalianMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
single cut NH-donor
Plasmid#83575PurposeeGFP reporter donor containing single SA cutting site for NHEJ knock-inDepositorInserteGFP
UseNhej donorTagsExpressionMutationPromoterAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRedCm
Plasmid#176225PurposeLambdaRed-expressing plasmid carrying the chloramphenicol acetyltransferase gene repressible by the CI repressor of lambda phageDepositorInsertLambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaB and PLAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-G4PID-HA
Plasmid#209639PurposeExpression G4PID-HA in mammalian cellsDepositorInsertG4PID (DHX36 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC133
Plasmid#198639PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.DepositorInsertdCas9
UseTags3x-FLAGExpressionBacterialMutationPromoterpTetAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
HB501: pMVP (L1-L4) RIP
Plasmid#121688PurposepMVP L1-L4 entry plasmid, contains rat Ins1 promoter (RIP) for 3-component MultiSite Gateway Pro assemblyDepositorInsertRat Ins1 promoter (RIP; β-cell specific)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
double cut NH-donor
Plasmid#83576PurposeeGFP reporter donor containing double SA cutting sites for NHEJ knock-inDepositorInserteGFP
UseNhej donorTagsExpressionMutationPromoterAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTmpKmH207in
Plasmid#176230PurposeA template plasmid for amplification of the cI-hok-neo cassette, which contains a truncated H207 promoter of T5 phage. The promoter is directed toward the cI gene.DepositorInsertcI of phage lambda, hok of the R1 plasmid, neo, truncated PH207 promoter of T5 phage
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTmpKmH207out
Plasmid#176231PurposeA template plasmid for amplification of the cI-hok-neo cassette, which contains a truncated H207 promoter of T5 phage. The promoter is directed outward the cI gene.DepositorInsertcI of phage lambda, hok of the R1 plasmid, neo, truncated PH207 promoter of T5 phage
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTmpKmA1O4out
Plasmid#176233PurposeA template plasmid for amplification of the cI-hok-neo cassette, which contains LacI-repressible A1O4 promoter. The promoter is directed outward the cI gene.DepositorInsertcI of phage lambda, hok of the R1 plasmid, neo, hybrid PA1O4 promoter
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE2-TetO-GFP-mSox17
Plasmid#206373PurposeExpresses EGFP fused mouse SOX17 in mammalian cells, for lentivirus generation.DepositorInsertSox17 (Sox17 Mouse)
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP‐RNASEH2C
Plasmid#108698PurposeFor expression of N-terminally eGFP-tagged human RNASEH2C in mammalian cellsDepositorInsertRNASEH2C (RNASEH2C Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN-CAG-mRFP-PCNA pc2729
Plasmid#166040PurposeExpresses mRFP tagged human PCNA in mammalian cells.DepositorInsertProliferating Cell Nuclear Antigen (PCNA Human)
UseTagsmRFPExpressionMammalianMutationPromoterCAGAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
4LNDDE488Q-pCDNA3.1(+)
Plasmid#172228PurposeExpresses ADAR2 Deaminase Domain (DD) hyperactive mutant E488Q fused with 4 repeats of lambda N peptide (4LN) in mammalian cellsDepositorInsertLambda N peptide - human ADAR2 Deaminase Domain E488Q
UseTags6xHis and FlagExpressionMammalianMutationchanged the Glutamic acid 488 in the Deaminase Do…PromoterCMVAvailable sinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GM
Plasmid#207527PurposeConditionally-replicating in Pseudomonas vector, medium-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
FlagMBNL1-41
Plasmid#96906Purposeexpresses Flag tagged human MBNL1-41 kDa isoform from pcDNA3.1 HisCDepositorInsertMBNL1-41 kDa isoform (MBNL1 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHY23-phage-ubc-nls-ha-stdMCP-tdTomato
Plasmid#164044PurposeExpression of stdMCP-tdTomato in mammalian cellsDepositorInsertstdMCP-tdTomato
UseLentiviralTagsExpressionMammalianMutationPromoterhuman ubiquitin C (UBC)Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEditA
Plasmid#207531PurposePlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertPlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9n-MS2-BB_BbsI
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-NLS-tdMCP-mCherry
Plasmid#99909PurposeFor the expression of NLS-tdMCP-mCherryDepositorInsertNLS-tdMCP-mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterTRE3GAvailable sinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AM77_pU6.Sa-gRNA.CLYBL
Plasmid#199237PurposeExpression construct encoding a S. aureus guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. aureus gRNA spacer
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNAAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-NLS-tdPCP-EGFP
Plasmid#99910PurposeFor the expression of NLS-tPMCP-EGFPDepositorInsertNLS-tdPCP-EGFP
UseLentiviralTagsExpressionMammalianMutationPromoterTRE4GAvailable sinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AlkB-D135T
Plasmid#160433PurposeA plasmid for expression in E. coli to produce His-tag fusion protein AlkB with Asp at position 135 mutated to ThrDepositorInsertE. coli AlkB
UseTagsHis-tagExpressionBacterialMutationChanged Aspartic acid 135 to Threonine; deleted t…PromoterT7Available sinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR-GFPuniv
Plasmid#46085PurposeIn vivo recombination assay fluorescent reporterDepositorInsertDR-GFPuniv reporter
UseRecombination reporter plasmidTagsExpressionMammalianMutationE5G and K163R mutations in EGFP relative to wild-…PromoterAvailable sinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
LB901: pMVP/PB/Blast-DEST
Plasmid#121873PurposepMVP destination vector, empty PiggyBac transposon vector backbone w/ Blast selection cassetteDepositorTypeEmpty backboneUsePiggybac transposon, pmvp gateway destination vec…TagsExpressionMammalianMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only