We narrowed to 3,402 results for: aaas
-
Plasmid#75600Purpose3rd generation lentiviral gRNA plasmid targeting human SRPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
NEK11 gRNA (BRDN0001144720)
Plasmid#75560Purpose3rd generation lentiviral gRNA plasmid targeting human NEK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001146865)
Plasmid#75481Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
UCK1 gRNA (BRDN0001148467)
Plasmid#77419Purpose3rd generation lentiviral gRNA plasmid targeting human UCK1DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for the shRNA and CMV for EGFPAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
OXSR1 gRNA (BRDN0001149240)
Plasmid#77749Purpose3rd generation lentiviral gRNA plasmid targeting human OXSR1DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
3692 pGEX4T-3 MLL AD mut.B
Plasmid#8864DepositorInsertMLL min A.D. (KMT2A Human)
TagsGSTExpressionBacterialMutationILPSDIMDFVL --> ILPSAAAAFVLAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
sgCTNNB1 Nicking
Plasmid#169845PurposeExpress a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.DepositorInsertsgCTNNB1 Nicking (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001148961)
Plasmid#77967Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001487120)
Plasmid#77966Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cGASsh4
Plasmid#127646PurposeKnock-down of human cGASDepositorInsertcGAS shRNA (CGAS Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-SRSF1 siRNA-resitant
Plasmid#218974PurposeVector for expressing siRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)DepositorInsertSRSF1 cDNA
ExpressionMammalianMutationsiRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGG…PromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001148426)
Plasmid#75545Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001147821)
Plasmid#76112Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-Anillin shRNA
Plasmid#187270PurposeLentiviral expression of shRNA targeting AnillinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna5-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128340PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only