We narrowed to 2,606 results for: EXO
-
Plasmid#184017PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 641 to 655.DepositorInsertProm1 SV8(-Ex19a) D-5 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMA3431
Plasmid#46876PurposeA lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3 mutant R592QDepositorInsertsoluble guanylate cyclase 1alpha 3 (Gucy1a3 Rat)
UseLentiviralTagsMycMutationR592QPromoterTRE-TightAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
373_ESR1 in pmiRGlo
Plasmid#78134Purposeluciferase reporter for miRNA activityDepositorInsertESR1 (ESR1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation3'UTR containing miRNA binding sitesPromoterPGKAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR418
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHBD00544
Plasmid#39639DepositorAvailable SinceAug. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
WDFY2-GFP
Plasmid#193636PurposeExpresses GFP-tagged WDFY2 in mammalian cellsDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-2pro and NbATML1-1pro
Plasmid#231154PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertTREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/GFPCD63
Plasmid#231709PurposeStably express CD63 fused with GFP in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
p40651-EFSNS-FMR1_e1ΔCGG-24xms2
Plasmid#222969PurposeMS2 mRNA reporter with FMR1 5' UTR (CGG repeats removed) and exon 1 sequenceDepositorInsertFMR1-ΔCGG 5' UTR and exon1
ExpressionMammalianMutation31 CGG repeats deleted from 5' UTRAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP9A(E195Q)-HA
Plasmid#209256PurposeMammalian expression of ATP9A mutant E195QDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP9B(E272Q)-HA
Plasmid#209257PurposeMammalian expression of ATP9B mutant E272QDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn HK1
Plasmid#220915PurposeNeuronal specific expression of HK1DepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only