We narrowed to 2,707 results for: EXO
-
Plasmid#82036PurposePlasmid for constitutive or doxycycline-inducible expression of H63D exonuclease-dead mutant of human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertMRE11 (MRE11 Human)
TagsHAExpressionMammalianMutationExonuclease-dead mutant: H63D MRE11PromoterCMV-tetAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shIFNAR
Plasmid#127699PurposeDoxycyclin inducible shRNA knockdown of mouse IFNAR geneDepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2400
Plasmid#144335PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TPST1-EGFP
Plasmid#66617PurposeEncodes GFP fusion of TPST1 trans Golgi marker; (Tyrosyl protein sulfotransferase 2)DepositorInsertTPST1 (TPST1 Human)
ExpressionMammalianAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_AsCas12a.DR
Plasmid#155050PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - AsCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and AsCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1-SF2
Plasmid#99020PurposeBacterial expression of SF2DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
SBP-GFP-Tac-TC
Plasmid#162506PurposeExpresses GFP tagged partial length Tac (TMD and cytosolic tail) in RUSH vector in mammalian cellsDepositorInsertGFP and SBP tagged partial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFP and SBPExpressionMammalianAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
608 pSG5L HA RB del ex4
Plasmid#10730DepositorAvailable SinceOct. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
Arf6 T27N- Venus in pcDNA3.1
Plasmid#90464PurposeRhoA mediated cell migrationDepositorAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG_NLS-Cas9-XTEN-Ec73RT-NLS_pA_pCMV_BFP_pA
Plasmid#176458PurposeVector for encoding a human codon-optimized SpCas9-XTEN-Ec73RT fusion driven by CAG promoter and tagBFP driven by CMV promoterDepositorInserthumanized S. pyogenes Cas9-XTEN-Ec73RT fusion
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CD 44 pGL4basic
Plasmid#78135Purposeluciferase reporter for miRNA activityDepositorAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 D-5
Plasmid#184017PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 641 to 655.DepositorInsertProm1 SV8(-Ex19a) D-5 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only