We narrowed to 13,079 results for: BASE

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#75410

tRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)

Diego Orzaez

Vazquez-Vilar et al Plant Methods. 2016 Feb 1;12:10. doi: 10

Aug. 5, 2016

Academic Institutions and Nonprofits only

#49075

Expresses human NKCC1 C820S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.

Biff Forbush

Somasekharan et al PLoS One. 2013 Dec 5;8(12):e82060. doi:

Nov. 25, 2013

Academic Institutions and Nonprofits only

#49076

Expresses human NKCC1 C1052S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.

Biff Forbush

Somasekharan et al PLoS One. 2013 Dec 5;8(12):e82060. doi:

Nov. 25, 2013

Academic Institutions and Nonprofits only

#49074

Expresses human NKCC1 C791S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.

Biff Forbush

Somasekharan et al PLoS One. 2013 Dec 5;8(12):e82060. doi:

Nov. 25, 2013

Academic Institutions and Nonprofits only

#49080

Expresses human NKCC1 mutant lacking cysteine residues within intracellular loops and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.

Biff Forbush

Somasekharan et al PLoS One. 2013 Dec 5;8(12):e82060. doi:

Nov. 22, 2013

Academic Institutions and Nonprofits only