We narrowed to 13,201 results for: BASE
-
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E3 (GB2240)
Plasmid#160562PurposetRNA and scaffold for the assembly of GBoligomers for the third position (positon [D3_4]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInserttRNA-gRNA position E3 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-N
Plasmid#156469PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-N protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-N (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-M
Plasmid#156470PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-M protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-M (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only