We narrowed to 10,397 results for: SEC
-
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-EYFP
Plasmid#231926PurposeCre-on/Flp-on EYFP under the Ef1a promoterDepositorInserteYFP with introns
UseAAVPromoterEf1aAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-9
Plasmid#228968PurposeFor bacterial expression of anti-GFP nanobody LaG94-9, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-10
Plasmid#228969PurposeFor bacterial expression of anti-GFP nanobody LaG94-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-10
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-12
Plasmid#228970PurposeFor bacterial expression of anti-GFP nanobody LaG94-12, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-3
Plasmid#228963PurposeFor bacterial expression of anti-GFP nanobody LaG94-3, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-8
Plasmid#228967PurposeFor bacterial expression of anti-GFP nanobody LaG94-8, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only