We narrowed to 163,788 results for: Des

#77925

3rd generation lentiviral gRNA plasmid targeting human MAPK14

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#98362

Lentiviral expression of PCBP1

William Hahn, Sefi Rosenbluh

Rosenbluh et al Cell Syst. 2016 Sep 28;3(3):302-316.e4.

Aug. 23, 2017

Academic Institutions and Nonprofits only

#98311

Lentiviral expression of ADSL

William Hahn, Sefi Rosenbluh

Rosenbluh et al Cell Syst. 2016 Sep 28;3(3):302-316.e4.

Aug. 23, 2017

Academic Institutions and Nonprofits only

#191013

Expresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)

Johanna Ivaska

Taskinen et al J Cell Biol. 2020 Jun 1;219(6). pii: 151

Nov. 15, 2022

Academic Institutions and Nonprofits only

#76444

3rd generation lentiviral gRNA plasmid targeting human MERTK

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#98376

Lentiviral expression of TUBG1

William Hahn, Sefi Rosenbluh

Rosenbluh et al Cell Syst. 2016 Sep 28;3(3):302-316.e4.

Aug. 10, 2017

Academic Institutions and Nonprofits only

#185289

For the mammalian expression of the synthetic protein iLID::eGFP::FTH1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation

Pamela Silver

Veling et al ACS Synth Biol. 2022 Mar 18;11(3):1292-1

June 9, 2022

Academic Institutions and Nonprofits only

#205995

inducible expression of HA-dnMCAK

Floris Foijer

Hong et al Nature. 2022 Jul;607(7918):366-373. doi:

Nov. 20, 2023

Academic Institutions and Nonprofits only

#77050

3rd generation lentiviral gRNA plasmid targeting human EIF2AK1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only