We narrowed to 15,621 results for: grna
-
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a_h7SK(PacI)_U6(I-SceI)_PGK-puro
Plasmid#189633PurposeLentiviral expression of dual AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK Cas12a gRNA cassette, hU6 Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin1 KI #2
Plasmid#139658PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: D23)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
retro-gRNA-eGFP
Plasmid#116926PurposeRetrovirus expressing eGFP with BBSI cloning sites for sgRNADepositorInserteGFP
UseRetroviralPromoterEF1aAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria1-GFP KI
Plasmid#131489PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2615
Plasmid#91078PurposeModule B, Promoter: AtU6, Gene: BsaI ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516b
Plasmid#91085PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, structurally optimized gRNA scaffold, (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDL639
Plasmid#231163PurposeT-DNA encoding TRV2 with mobile gRNAs targeting SlHAIRPLUS and SlAN2DepositorInsertmobile gRNAs targeting SlHAIRPLUS and SlAN2
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MTK234_056
Plasmid#123921PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (human u6 promoter and constant region 3) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-hu6_20N_cr3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_MBD1_iso1_2
Plasmid#86304PurposeEncodes gRNA for 3' target of human MBD1_iso1DepositorInsertgRNA against MBD1_iso1 (MBD1 Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only